A practical reference on fatty acid oxidation: what it is, how it behaves, what the literature reports, and where the honest uncertainties sit.
Reviewed 2026-07-06. Anything still debated is marked as such rather than presented as settled.
The pharmacological interest in cardarine centers on PPARδ activation and its downstream effects on lipid handling and mitochondrial function. In animal studies, PPARδ agonists have been associated with changes in exercise endurance and fatty acid utilization, though results vary by model and protocol. Human data remain sparse, and the absence of large controlled trials limits conclusions about efficacy. Researchers often describe the compound as a tool for probing PPARδ biology rather than a proven therapeutic agent.
Safety discussions about cardarine frequently cite rodent carcinogenicity findings reported in the 2000s. In those studies, treated animals developed tumors at multiple sites, leading sponsors to discontinue clinical development. The relevance of these findings to humans has not been resolved, but they are a major reason the compound is not approved. Current literature emphasizes uncertainty about long-term effects and the risks of unregulated use. Regulators and health agencies have not established a safe human exposure level.
Cardarine is not approved for human therapeutic use in any major jurisdiction. It appears on the World Anti-Doping Agency Prohibited List as a PPARδ agonist within the hormone and metabolic modulators category. Sports organizations test for it because it has been detected in athlete samples and seized products. Regulatory actions against marketed research chemical versions have occurred in several countries, though enforcement varies. Availability through unregulated channels complicates oversight.
Analytical laboratories typically identify cardarine and its metabolites using liquid chromatography-tandem mass spectrometry. Urine is a common matrix in anti-doping testing, while blood and tissue may be used in research settings. Detection windows depend on the assay, the sample matrix, and the compound's metabolism. Because cardarine is extensively metabolized, laboratories often target specific metabolites to improve sensitivity and confirmation. Reference standards are required for reliable quantification. Method validation includes checks for selectivity, linearity, and carryover.
| Property | Value | Notes |
|---|---|---|
| Common synonyms | GW501516, GW-501516, GW 501516, endurobol | Names vary in research and anti-doping documents. |
| Chemical class | Synthetic PPARδ agonist | Small-molecule nuclear receptor ligand. |
| CAS Registry Number | 317318-70-0 | Identifier commonly associated with GW501516. |
| Appearance | White to off-white powder | Typical for purified research material. |
| Solubility | Low in water; soluble in DMSO and ethanol | Organic solvents are common for laboratory stock solutions. |
GW501516 acts as a ligand for PPAR delta, a nuclear receptor that regulates transcription of genes involved in fatty acid oxidation and energy use. Activation of this receptor in skeletal muscle shifts metabolism toward fat burning in animal models. The compound does not burn fat directly; it changes gene expression over hours to days. Researchers study it to understand metabolic flexibility and exercise adaptation. Effects observed in rodents are not automatically expected in humans.
Preclinical research reported that GW501516 increased running endurance in mice and improved lipid profiles in some animal species. Early human trials explored effects on high-density lipoprotein cholesterol, triglycerides, and glucose handling, but the program was discontinued. Published human data are sparse and do not establish efficacy for any condition. Studies also examined PPAR delta in cancer biology, with conflicting findings across models. The relationship between receptor activation, tissue context, and disease risk remains an active area of investigation.
Anti-doping laboratories identify GW501516 and its metabolites using liquid chromatography-tandem mass spectrometry. Urine is the usual matrix, and detection can occur after the parent compound has cleared from blood. The exact detection window depends on dose, formulation, individual metabolism, and assay sensitivity. Because the compound is prohibited at all times, athletes are subject to testing in and out of competition. Analytical methods continue to improve as new metabolites and designer analogs are characterized.
At the molecular level, GW501516 binds and activates PPARδ, a nuclear receptor that regulates transcription. Activation shifts expression of genes involved in fatty acid oxidation, energy expenditure, and lipid transport in skeletal muscle and liver. Animal studies report increased endurance and altered lipid profiles after exposure. Human data are limited to small trials and do not establish long-term safety or efficacy. PPARδ also has roles in cell proliferation, so the relationship between activation and cancer risk remains an open question.
Published literature on cardarine includes in vitro assays, rodent experiments, and a small number of human studies. Reports describe effects on exercise capacity and lipid metabolism in animals, while human evidence is sparse. Many online descriptions present the compound as a proven endurance aid, a claim not supported by regulatory approval or large clinical trials. Analytical studies focus on identifying the parent compound and its metabolites in biological samples. Important uncertainties include species differences, dose-response relationships, and the relevance of rodent tumor findings to humans.
Cardarine is frequently described as a fat-burning or endurance-enhancing supplement, but these claims exceed the available evidence. The compound is not a hormone, steroid, or selective androgen receptor modulator. Research articles discuss it as a tool compound for studying PPARδ biology, while anti-doping literature focuses on its abuse and detection. Quality of unapproved products is uncertain, and independent analyses have found impurities or incorrect labeling. Open questions include whether human cancer risk resembles that seen in rodents and how often non-athletes use the substance.
Cardarine has no approved therapeutic indication and is not marketed as a medicine. The World Anti-Doping Agency lists GW501516 as a prohibited substance at all times, covering both in-competition and out-of-competition periods. National laws vary: some countries treat it as an unapproved drug subject to import controls, while others have specific restrictions on sale for human consumption. It is often sold as a research chemical, a label that does not imply safety or legality. Enforcement actions have targeted online vendors and shipments.
Anti-doping laboratories identify GW501516 and related metabolites using liquid chromatography coupled with tandem mass spectrometry. Urine is the most common matrix, though blood and dried blood spots may also be analyzed. The method targets the parent compound and phase I and phase II metabolites, which extend the detection window. Because the substance is prohibited at all times, athletes can be tested outside competition. Detection limits and windows depend on the assay, sample type, and individual metabolism.
A curriculum revision effort involving more clinical instruction in the first two years of medical school was unveiled for the entering class of 2011. In conjunction with the University of Cincinnati Medical Center, the college also sponsors 56 accredited residency and fellowship training programs through the Office of Graduate Medical Education.
== Side effects == Adverse effects are similar to other opioids and include drowsiness, constipation, vertigo, nausea, vomiting, and respiratory depression. Contraindications include asthma, respiratory insufficiency, and age under eight. Ethylmorphine may affect the user's ability to drive and operate heavy machinery, and may cause chemical dependence or addiction at high doses.
During 2020, as the COVID‑19 pandemic escalated globally and vaccine development intensified, the World Health Organization (WHO) COVAX facility adopted the motto "No one is safe unless everyone is safe" to emphasize the need for equitable vaccination. The facility set a goal of supplying COVID‑19 vaccines to nearly 100 low-to-middle income countries that could not afford them. COVAX sought to fundraise US$6.8 billion to purchase and deliver vaccines to participating countries in proportion to their populations. On 18 December 2020, the facility announced agreements with vaccine manufacturers to supply 1.3 billion doses for 92 low-middle income countries in the first half of 2021. Yet, by mid-December, some 16 countries representing only 14% of the world's population had preordered more than 10 billion vaccine doses or about 51% of the available world supply. Specifically, Canada, Australia, and Japan – having only 1% of the world's COVID‑19 cases – had collectively reserved some 1 billion vaccine doses, while the COVAX facility had reserved only a few hundred million doses. At the Group of Seven summit in June 2021, the United States promised to distribute 500 million vaccine doses internationally; this distribution began on 17 August. Preorders from rich countries were made during 2020 with 13 different vaccine manufacturers, whereas those for low-to-middle income countries were made primarily for the Oxford–AstraZeneca COVID-19 vaccine, which is lowest in cost and has no special refrigeration needs.
Sources: en.wikipedia.org
Respect for the physical remains. If left lying on top of the ground, scavengers may eat the corpse, considered disrespectful to the deceased in many (but not all) cultures. In Tibet, sky burials deliberately encourage scavenging of human remains in the interest of returning them to nature, just as within Zoroastrianism, where burial and cremation were often seen as impure (as human remains are polluted, while the earth and fire are sacred). Burial can be seen as an attempt to bring closure to the deceased's family and friends. Psychologists in some Western Judeo-Christian quarters, as well as the US funeral industry, claim that by interring a body away from plain view the pain of losing a loved one can be lessened. Many cultures believe in an afterlife. Burial is sometimes believed to be a necessary step for an individual to reach the afterlife. Many religions prescribe a particular way to live, which includes customs relating to disposal of the dead. A decomposing body releases unpleasant gases related to decomposition. As such, burial is seen as a means of preventing smells from expanding into open air.
== India == 7-Eleven - Just in Metro Cities Central Bazaar - National Player DMart - National Player HyperCity - Just in Metro cities Kurinji Metro Bazaar - Regional Player Lulu Hypermarket - Just in Metro Cities Maveli Stores - Regional Player More - Regional Player Namdhari's Fresh - Regional Player Nesto - Regional Player Nilgiri's - Regional Player Reliance Fresh - National Player Smart Bazaar - National Player Spar - In Metro cities Spencer's Retail - Regional Player Triveni Supermarkets - Regional Player Valuezone Hypermarket - Regional Player Walmart - Just in Metro Cities
=== Adverse action and exceptions === The Fair Work Act 2009 section 351 enables complaints of discrimination to be made against "an employer" for "adverse action against a person who is an employee, or prospective employee". Independent contractors therefore must bring actions in state law where possible. The grounds for a complaint are based on five groups of protected characteristics, namely (a) race, colour, religion, political opinion, national extraction or social origin, (b) sex, sexual orientation, marital status, (c) age, (d) physical or mental disability, and (e) pregnancy, family or carer responsibility. If a complainant establishes that there is adverse action, and a prohibited ground, the onus of proof shifts to the employer which must prove that their reason for action was not tainted by the person's protected characteristic.
Sources: en.wikipedia.org
2) Order 1993 (S.I. 1993/1821) Occupational Pension Schemes (Preservation of Benefit) Amendment Regulations 1993 (S.I. 1993/1822) Offshore Safety (Repeals and Modifications) Regulations 1993 (S.I. 1993/1823) Export of Goods (Control) (Amendment No. 4) Order 1993 (S.I. 1993/1825) Financial Services (Disclosure of Information) (Designated Authorities) (No. 7) Order 1993 (S.I. 1993/1826) Church of England (Legal Aid) Rules 1993 (S.I. 1993/1840) Diocesan Chancellorship Regulations 1993 (S.I. 1993/1841) Ecclesiastical Judges and Legal Officers (Fees) Order 1993 (S.I. 1993/1842) Legal Officers (Annual Fees) Order 1993 (S.I. 1993/1843) Parochial Fees Order 1993 (S.I. 1993/1844) Local Government Superannuation (Investments) Regulations 1993 (S.I. 1993/1848) Highways (Traffic Calming) Regulations 1993 (S.I. 1993/1849) Education (Mandatory Awards) Regulations 1993 (S.I. 1993/1850) Social Security (Invalid Care Allowance) Amendment (No. 2) Regulations 1993 (S.I. 1993/1851) Assisted Areas Order 1993 (S.I. 1993/1877) Seed Potatoes (Amendment) Regulations 1993 (S.I. 1993/1878) Public Telecommunication System Designation (City of London Telecommunications Ltd) Order 1993 (S.I. 1993/1879) Public Telecommunication System Designation (Ionica L3 Ltd) Order 1993 (S.I. 1993/1880) Companies Act 1989 (Recognised Supervisory Bodies) (Periodical Fees) Regulations 1993 (S.I. 1993/1881) Learning for Work (Scottish Enterprise and Highlands and Islands Enterprise Programmes) Order 1993 (S.I. 1993/1882) Norway Lobsters (Prohibition of Method of Fishing) Order 1993 (S.I.
== Use == In agriculture and horticulture, lime sulfur is sold as a spray to control fungi, bacteria, and insects. On deciduous trees, it can be sprayed during the winter on the surface of the bark in high concentrations, but because lime sulfur can burn foliage, it must be heavily diluted before being sprayed onto herbaceous crops, especially during warm weather. Lime sulfur is approved for use on organic crops in the European Union and the United Kingdom. Bonsai enthusiasts use undiluted lime sulfur to bleach, sterilize, and preserve deadwood on bonsai trees while giving it an aged look. Rather than being sprayed over the entire tree, as in pesticidal use, lime sulfur is painted directly onto the exposed deadwood and is often colored with a small amount of dark paint to make it look more natural. Without added pigments, the lime sulfur solution bleaches wood to a bone-white color that takes time to weather and become natural-looking. In the very specific case of bonsai culture, if lime sulfur is carefully applied by hand with a small brush and does not come into direct contact with the leaves or needles, this technique can also be used on evergreen bonsai trees as well as other types of green trees. However, this does not apply to normal use on common trees with green leaves. Diluted solutions of lime sulfur (between 1:16 and 1:32) are also used as a dip for pets to help control ringworm (a fungus), mange, and other dermatoses and parasites. Undiluted lime sulfur is corrosive to the skin and eyes and can cause serious injury, such as blindness.
In pre-life, a 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within the variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation. Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor), the T loop evolved to interact with the D loop at the tRNA "elbow" (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth.
The human immunodeficiency virus (or HIV) is a difficult target to find and eradicate. The earliest tests for infection relied on the presence of antibodies to the virus circulating in the bloodstream. However, antibodies don't appear until many weeks after infection, maternal antibodies mask the infection of a newborn, and therapeutic agents to fight the infection don't affect the antibodies. PCR tests have been developed that can detect as little as one viral genome among the DNA of over 50,000 host cells. Infections can be detected earlier, donated blood can be screened directly for the virus, newborns can be immediately tested for infection, and the effects of antiviral treatments can be quantified. Some disease organisms, such as those for tuberculosis, are difficult to sample from patients and slow to be grown in the laboratory. PCR-based tests have allowed detection of small numbers of disease organisms (both live and dead) in convenient samples. Detailed genetic analysis can also be used to detect antibiotic resistance, allowing immediate and effective therapy. The effects of therapy can also be immediately evaluated. The spread of a disease organism through populations of domestic or wild animals can be monitored by PCR testing. In many cases, the appearance of new virulent subtypes can be detected and monitored. The subtypes of an organism that were responsible for earlier epidemics can also be determined by PCR analysis. Viral DNA can be detected by PCR.
Sources: en.wikipedia.org
Cardarine is an investigational synthetic compound that acts as a PPARδ agonist. It is also known as GW501516 and has been studied mainly in preclinical research. It is not an approved medicine.
No. Cardarine is not a steroid hormone; it targets the nuclear receptor PPARδ. Its classification in anti-doping rules differs from anabolic steroids, though it remains prohibited in sport.
Early rodent studies reported tumor formation at multiple sites, which raised safety concerns. Sponsors stopped clinical development, and no approved human product exists.
No. Cardarine has not received approval for human therapeutic use in major jurisdictions. It remains an investigational compound.